ID: 1002177469_1002177480

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1002177469 1002177480
Species Human (GRCh38) Human (GRCh38)
Location 5:177409380-177409402 5:177409432-177409454
Sequence CCACAGGTCATGAGCAGAGGCCA GAACAATCCTGGGACAATCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 245} {0: 1, 1: 0, 2: 1, 3: 10, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!