ID: 1002182475_1002182480

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1002182475 1002182480
Species Human (GRCh38) Human (GRCh38)
Location 5:177437957-177437979 5:177437986-177438008
Sequence CCTGGAGATAATGAGGCCCACTG GTCCTGCCCTTACATTCTAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 151} {0: 1, 1: 1, 2: 2, 3: 15, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!