ID: 1002183424_1002183432

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1002183424 1002183432
Species Human (GRCh38) Human (GRCh38)
Location 5:177442957-177442979 5:177442982-177443004
Sequence CCAGCTGGAAGCGGGAAGGGATT AGGTGGGCCTGGAGGGAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 27, 4: 139} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!