ID: 1002187773_1002187780

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1002187773 1002187780
Species Human (GRCh38) Human (GRCh38)
Location 5:177462526-177462548 5:177462539-177462561
Sequence CCCCCTCCGCTGTGAGCAACGCA GAGCAACGCAGGATGAGGACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79} {0: 1, 1: 0, 2: 0, 3: 16, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!