ID: 1002188441_1002188447

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1002188441 1002188447
Species Human (GRCh38) Human (GRCh38)
Location 5:177466859-177466881 5:177466878-177466900
Sequence CCGTCAGGGTGCGCCCGGGGGCC GGCCCCTGGAGCGCTCCGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 161} {0: 1, 1: 0, 2: 2, 3: 13, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!