ID: 1002194900_1002194908

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1002194900 1002194908
Species Human (GRCh38) Human (GRCh38)
Location 5:177496454-177496476 5:177496483-177496505
Sequence CCTTGCAGCCGGAAGCCCCAAGG CCCCTCCAGCACTACTTTGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 14, 4: 170} {0: 1, 1: 0, 2: 0, 3: 6, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!