ID: 1002202630_1002202634

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1002202630 1002202634
Species Human (GRCh38) Human (GRCh38)
Location 5:177538824-177538846 5:177538838-177538860
Sequence CCACCTGAGGACAGGGAACAGCC GGAACAGCCTGACTTCCTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 247} {0: 1, 1: 0, 2: 1, 3: 10, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!