ID: 1002211912_1002211919

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1002211912 1002211919
Species Human (GRCh38) Human (GRCh38)
Location 5:177604401-177604423 5:177604425-177604447
Sequence CCCCCACCGCCTGGCAGTGCTGG GCCCTTCCGCGAACGCTTCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 488} {0: 1, 1: 0, 2: 0, 3: 0, 4: 14}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!