ID: 1002227448_1002227454

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1002227448 1002227454
Species Human (GRCh38) Human (GRCh38)
Location 5:177734093-177734115 5:177734135-177734157
Sequence CCCCAGACTCACTGACCACAGCA ACATGAGCAGGCCCCTTGCACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 25, 4: 277} {0: 2, 1: 0, 2: 3, 3: 18, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!