ID: 1002227451_1002227454

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1002227451 1002227454
Species Human (GRCh38) Human (GRCh38)
Location 5:177734108-177734130 5:177734135-177734157
Sequence CCACAGCACCACATGAATTCACA ACATGAGCAGGCCCCTTGCACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 36, 4: 276} {0: 2, 1: 0, 2: 3, 3: 18, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!