ID: 1002263033_1002263052

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1002263033 1002263052
Species Human (GRCh38) Human (GRCh38)
Location 5:178007547-178007569 5:178007583-178007605
Sequence CCCCAGGCCCGGCTTCCCCGCAG GCCTCGGAGGGCACCCTCAGAGG
Strand - +
Off-target summary {0: 12, 1: 3, 2: 5, 3: 52, 4: 302} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!