ID: 1002276061_1002276069

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1002276061 1002276069
Species Human (GRCh38) Human (GRCh38)
Location 5:178105004-178105026 5:178105045-178105067
Sequence CCTGGCTTGCCTGATTGGCTGAA GGTGTGAGCAGACCGCTAGGTGG
Strand - +
Off-target summary {0: 3, 1: 5, 2: 1, 3: 6, 4: 127} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!