ID: 1002282096_1002282102

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1002282096 1002282102
Species Human (GRCh38) Human (GRCh38)
Location 5:178137097-178137119 5:178137125-178137147
Sequence CCTCTCAAGTAGTCGAGGAGGTA GATGGAGAGCAGGCCAGGTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 112, 4: 911}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!