ID: 1002302905_1002302911

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1002302905 1002302911
Species Human (GRCh38) Human (GRCh38)
Location 5:178267606-178267628 5:178267634-178267656
Sequence CCAGACATTGTGGAGCAGAGACA TCCCACTGTGTCCTCTGGAAGGG
Strand - +
Off-target summary {0: 3, 1: 21, 2: 51, 3: 120, 4: 371} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!