ID: 1002304618_1002304625 |
View in Genome Browser |
Spacer: -3 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1002304618 | 1002304625 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 5:178275869-178275891 | 5:178275889-178275911 |
| Sequence | CCCTCCATGATCCCCTTAAACAC | CACCCTGGCCCAGAACTCCTTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 1, 2: 8, 3: 194, 4: 2872} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||