ID: 1002308127_1002308134

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1002308127 1002308134
Species Human (GRCh38) Human (GRCh38)
Location 5:178296357-178296379 5:178296405-178296427
Sequence CCTGCTGCAACCTCACTAGGTGC CCAGAAAGGCTACCATGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 618} {0: 1, 1: 0, 2: 1, 3: 14, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!