ID: 1002314594_1002314597

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1002314594 1002314597
Species Human (GRCh38) Human (GRCh38)
Location 5:178334919-178334941 5:178334933-178334955
Sequence CCACATAGCCTGTGCCTCCCCCA CCTCCCCCACACCCCAGACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 77, 4: 493} {0: 1, 1: 0, 2: 10, 3: 82, 4: 691}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!