ID: 1002328041_1002328048

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1002328041 1002328048
Species Human (GRCh38) Human (GRCh38)
Location 5:178422549-178422571 5:178422572-178422594
Sequence CCCGCTGTCTGCACGTCCCTGAG CCACAGCAACCCAGCAGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 26, 4: 250} {0: 1, 1: 0, 2: 2, 3: 33, 4: 424}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!