ID: 1002335681_1002335686

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1002335681 1002335686
Species Human (GRCh38) Human (GRCh38)
Location 5:178476655-178476677 5:178476677-178476699
Sequence CCAGCAGCATTCTGTGAACTCCA ACAAGGGCCCTGGATGTGCGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 11, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!