ID: 1002337085_1002337092

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1002337085 1002337092
Species Human (GRCh38) Human (GRCh38)
Location 5:178487224-178487246 5:178487244-178487266
Sequence CCAGCCCAGGCCAGGGCTTCCCT CCTGGTAAATCAATCTCTGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 72, 4: 637} {0: 1, 1: 0, 2: 0, 3: 12, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!