ID: 1002342694_1002342701

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1002342694 1002342701
Species Human (GRCh38) Human (GRCh38)
Location 5:178527238-178527260 5:178527281-178527303
Sequence CCTGGGGCTGGTCTGAGCTGACT GAGCTCTCCCTTCTGTGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 241} {0: 1, 1: 0, 2: 3, 3: 26, 4: 278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!