ID: 1002347109_1002347115

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1002347109 1002347115
Species Human (GRCh38) Human (GRCh38)
Location 5:178555786-178555808 5:178555801-178555823
Sequence CCCTGGGATGCCCCCGAGTCACT GAGTCACTACTGTTCACAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 68} {0: 1, 1: 0, 2: 0, 3: 11, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!