ID: 1002347112_1002347123

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1002347112 1002347123
Species Human (GRCh38) Human (GRCh38)
Location 5:178555797-178555819 5:178555832-178555854
Sequence CCCCGAGTCACTACTGTTCACAG GGACCATAGGGCAGCTCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 63} {0: 1, 1: 0, 2: 1, 3: 12, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!