ID: 1002385062_1002385073

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1002385062 1002385073
Species Human (GRCh38) Human (GRCh38)
Location 5:178860284-178860306 5:178860324-178860346
Sequence CCGCTCCGGTGCCGCTGCCGACG CGCCGCCCGCCGTGAACGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 97} {0: 1, 1: 0, 2: 0, 3: 1, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!