|
Left Crispr |
Right Crispr |
| Crispr ID |
1002386765 |
1002386767 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:178873906-178873928
|
5:178873952-178873974
|
| Sequence |
CCATCAGTGTTTGTAGTTTTCAT |
TTCTTTTTTTTTTTTTGAGATGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 3017, 1: 89714, 2: 69208, 3: 85321, 4: 120915} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|