ID: 1002390036_1002390037

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1002390036 1002390037
Species Human (GRCh38) Human (GRCh38)
Location 5:178903486-178903508 5:178903499-178903521
Sequence CCATTTTTATATTGAGTTATTTA GAGTTATTTACATATAAAAGAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 85, 3: 602, 4: 3680} {0: 1, 1: 0, 2: 3, 3: 116, 4: 1557}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!