ID: 1002399765_1002399770

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1002399765 1002399770
Species Human (GRCh38) Human (GRCh38)
Location 5:178985118-178985140 5:178985132-178985154
Sequence CCCTGTGCCTCTCATCCACACTG TCCACACTGCCCCAGGGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 297} {0: 1, 1: 0, 2: 3, 3: 38, 4: 292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!