ID: 1002421650_1002421664

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1002421650 1002421664
Species Human (GRCh38) Human (GRCh38)
Location 5:179152269-179152291 5:179152306-179152328
Sequence CCATAGCTTGCCAGGTCCCTCCC CCAGGGATGCCACCCACCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 15, 4: 177} {0: 1, 1: 0, 2: 8, 3: 51, 4: 371}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!