ID: 1002424940_1002424953

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1002424940 1002424953
Species Human (GRCh38) Human (GRCh38)
Location 5:179169444-179169466 5:179169477-179169499
Sequence CCAGCCTTAGTGCCTCCTAGTTC GGTAGGTCTGGGTGAGGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 138} {0: 1, 1: 0, 2: 3, 3: 60, 4: 607}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!