|
Left Crispr |
Right Crispr |
| Crispr ID |
1002436854 |
1002436867 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:179236843-179236865
|
5:179236883-179236905
|
| Sequence |
CCCAAAATTCATATGTTGAAACC |
ATTTTAGGAGGTGGGGCCTTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 123, 1: 846, 2: 2215, 3: 3638, 4: 4509} |
{0: 2, 1: 51, 2: 480, 3: 1439, 4: 2684} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|