ID: 1002436860_1002436867 |
View in Genome Browser |
Spacer: -10 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1002436860 | 1002436867 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 5:179236870-179236892 | 5:179236883-179236905 |
Sequence | CCCCAGAGGGATGATTTTAGGAG | ATTTTAGGAGGTGGGGCCTTTGG |
Strand | - | + |
Off-target summary | No data | {0: 2, 1: 51, 2: 480, 3: 1439, 4: 2684} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |