ID: 1002440253_1002440259

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1002440253 1002440259
Species Human (GRCh38) Human (GRCh38)
Location 5:179260638-179260660 5:179260689-179260711
Sequence CCTGGCTCCCACTGTTTCTACAG CAGTTTCCTCATCTGTAACGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 27, 4: 248} {0: 2, 1: 166, 2: 1596, 3: 5845, 4: 12360}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!