ID: 1002440253_1002440260

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1002440253 1002440260
Species Human (GRCh38) Human (GRCh38)
Location 5:179260638-179260660 5:179260690-179260712
Sequence CCTGGCTCCCACTGTTTCTACAG AGTTTCCTCATCTGTAACGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 27, 4: 248} {0: 2, 1: 128, 2: 1296, 3: 4927, 4: 10986}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!