ID: 1002440424_1002440434

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1002440424 1002440434
Species Human (GRCh38) Human (GRCh38)
Location 5:179261770-179261792 5:179261802-179261824
Sequence CCACAGTTCCTGCATCCATTCAT TCTGGGGTCCCTCCCCACAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 344, 4: 3211} {0: 1, 1: 0, 2: 3, 3: 25, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!