ID: 1002441269_1002441275

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1002441269 1002441275
Species Human (GRCh38) Human (GRCh38)
Location 5:179265672-179265694 5:179265694-179265716
Sequence CCTCGGCTTTCCCAGCGCCGGCC CCCCGCCCACCCCTTCCGCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 181} {0: 1, 1: 0, 2: 1, 3: 22, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!