ID: 1002447893_1002447895

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1002447893 1002447895
Species Human (GRCh38) Human (GRCh38)
Location 5:179301248-179301270 5:179301277-179301299
Sequence CCAGCCGAAACTTGAGATCTTTA AATCCCCACTCTGTCACTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 125} {0: 1, 1: 0, 2: 3, 3: 24, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!