ID: 1002452377_1002452386

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1002452377 1002452386
Species Human (GRCh38) Human (GRCh38)
Location 5:179326253-179326275 5:179326293-179326315
Sequence CCCCAGGAATGCTGTATTGGCGG TTGGCCTCAGCCATGTCCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60} {0: 1, 1: 0, 2: 2, 3: 15, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!