ID: 1002461704_1002461711

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1002461704 1002461711
Species Human (GRCh38) Human (GRCh38)
Location 5:179377058-179377080 5:179377109-179377131
Sequence CCAGGCACCATCTAGATCCACAA CTCACTCCTGTCTCAGGACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 124} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!