ID: 1002475346_1002475360

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1002475346 1002475360
Species Human (GRCh38) Human (GRCh38)
Location 5:179461982-179462004 5:179462028-179462050
Sequence CCTCCACCCCATGCCTGGCACCG CAGCCGCATACTCCTGTTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 274, 4: 1864} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!