ID: 1002483390_1002483394 |
View in Genome Browser |
Spacer: -7 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1002483390 | 1002483394 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 5:179517940-179517962 | 5:179517956-179517978 |
| Sequence | CCCTCTGCTGGTCCACGGGGGCC | GGGGGCCGCTGCAGCTGGCCAGG |
| Strand | - | + |
| Off-target summary | {0: 2, 1: 0, 2: 1, 3: 8, 4: 174} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||