ID: 1002484074_1002484091

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1002484074 1002484091
Species Human (GRCh38) Human (GRCh38)
Location 5:179522987-179523009 5:179523038-179523060
Sequence CCTGAGCCCGGGCTCATCAGCCG GCCTCTGTGTGAGGTGCTCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!