ID: 1002493789_1002493798

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1002493789 1002493798
Species Human (GRCh38) Human (GRCh38)
Location 5:179598458-179598480 5:179598508-179598530
Sequence CCTTCTCCCCTGCGTAAGTGTCA CTGGTTCCTGCTCTTTCTTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 54, 4: 634}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!