ID: 1002500079_1002500083

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1002500079 1002500083
Species Human (GRCh38) Human (GRCh38)
Location 5:179642629-179642651 5:179642655-179642677
Sequence CCTCGGATCACTCGAGGGCTAGA CACCCACCAGGTGTGTGGACAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 0, 4: 24} {0: 3, 1: 0, 2: 1, 3: 15, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!