|
Left Crispr |
Right Crispr |
| Crispr ID |
1002506375 |
1002506379 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:179681970-179681992
|
5:179681992-179682014
|
| Sequence |
CCAGGCGCGATGTTTCATGCCTG |
GTAAATCCCAGCACTTTGGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 17, 2: 698, 3: 12492, 4: 74655} |
{0: 415, 1: 1042, 2: 7646, 3: 340289, 4: 269048} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|