ID: 1002506377_1002506387 |
View in Genome Browser |
Spacer: -7 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1002506377 | 1002506387 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 5:179681989-179682011 | 5:179682005-179682027 |
| Sequence | CCTGTAAATCCCAGCACTTTGGG | CTTTGGGAGGGGAAGGTGGGTGG |
| Strand | - | + |
| Off-target summary | {0: 397, 1: 895, 2: 1315, 3: 5899, 4: 5416} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||