ID: 1002508645_1002508652

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1002508645 1002508652
Species Human (GRCh38) Human (GRCh38)
Location 5:179698589-179698611 5:179698603-179698625
Sequence CCAGGAACCAGACGGGTGAGGGC GGTGAGGGCTACTGGGGGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 111} {0: 1, 1: 0, 2: 1, 3: 32, 4: 305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!