ID: 1002517709_1002517712

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1002517709 1002517712
Species Human (GRCh38) Human (GRCh38)
Location 5:179772024-179772046 5:179772041-179772063
Sequence CCCATGTTTTCTGCCTTCAGACC CAGACCCATCTGACATTTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 257} {0: 1, 1: 0, 2: 1, 3: 9, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!