ID: 1002521187_1002521196

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1002521187 1002521196
Species Human (GRCh38) Human (GRCh38)
Location 5:179794033-179794055 5:179794065-179794087
Sequence CCCCAGCTCGCCTTCACACACAG CCACACCGACGGTACCATGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 224} {0: 1, 1: 0, 2: 1, 3: 1, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!