ID: 1002523484_1002523488

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1002523484 1002523488
Species Human (GRCh38) Human (GRCh38)
Location 5:179803784-179803806 5:179803800-179803822
Sequence CCACACCAACCCTTCTGTCATTT GTCATTTCCCTACACACTGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 33, 4: 381} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!