ID: 1002524168_1002524181

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1002524168 1002524181
Species Human (GRCh38) Human (GRCh38)
Location 5:179806433-179806455 5:179806454-179806476
Sequence CCGCCGCCGACGCCCAGGTGCGC GCCAGGTGCGGGCCGGGCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 162} {0: 1, 1: 0, 2: 3, 3: 47, 4: 527}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!